Spot-Tag Cloning Vectors

Create Your Own Spot-Tag Protein

These 12 amino acids will make all the difference

The Spot-Tag Fusion Protein System is the first "create-your-own" peptide-tag specifically designed for use with the “nanobody” suite of products. Nanobodies are small, high-performance fragments of monoclonal antibodies that show superior performance across a wide range of detection, purification, and imaging applications. This connection allows any lab to easily construct and express a single Spot-Tag fusion protein, which can then be used with any of our capture or detection applications. For example, the Spot-Trap Affinity Reagents can be used to purify any Spot-Tagged protein in a single step, whether by a simple immunoprecipitation or by ultrapure affinity purification – even under gentle conditions that preserve protein function. The same Spot-Tagged protein can also be detected with the tiny and rugged Spot-Label, which will specifically bind for ultra-sensitive Western Blotting and ultra-bright immunofluorescence (or even super-resolution microscopy).

 



 

 
LITERATURE
See Below for Data Sheets
 
RELATED PRODUCTS
Spot-Label
Spot-Trap Affinity Reagents
Nanobody-Trap Reagents
Antibodies
Live Cell Imaging Systems

 

Spot-Tag Fusion Protein Uses

 

The Spot-Tag system is fully validated! The Spot-Tag sequence is: PDRVRAVSHWSS. It’s just 1.4kDa, and can easily be placed at either the C-terminus or the N-terminus without impacting your target protein’s function. In practical experiments, it has proven to be completely inert, easy to clone, and to express at good levels in bacteria, yeast, mammalian, and insect cell lines. The Spot-Nanobody’s sequence and structure are known as well; its binding mechanism with Spot-Tag has been elucidated. Spot-Nanobody is produced recombinantly for consistently high quality. Precise production guarantees performance no matter the configuration: affinity purification (Spot-Trap), immunoprecipitation (Spot-Trap), Westerns (Spot-Label monovalent form), and immunofluorescence (Spot-Label divalent form) are all possible.

 

Spot advantages compared to Flag

More robust & stable

Higher affinity

Less background

Higher resolution

Less negatively charged

Shorter than other tags

Less nonspecific binding

Inert

 

N-terminus and C-terminus

Codon optimized sequences for Spot-Tag:

E. coli: CCGGATCGCGTGCGCGCAGTCTCTCACTGGAGCAGC S. cerevisiae: CCAGATAGAGTTAGAGCTGTTTCTCATTGGTCTTCT Human cell line: CCAGACCGCGTGCGCGCCGTGAGCCATTGGAGCAGC

 

Optional Linker

We recommend a short Gly-Ser linker, if there are adjacent acidic amino acids (Glu/Asp):

E. coli: GGTTCT

S. cerevisiae: GGTTCT

Human cell line: GGCAGC

 

Spot vectors for cloning

Vector Data- sheet Sequence file
pSpot1 vector, E. coli, Spot-tag N-term., Kan., high expression ev-1.pdf ev-1.gb
pSpot2 vector,  E. coli, Spot-tag C-term., Kan., high expression ev-2.pdf ev-2.gb
pSpot3 vector, E. coli, Spot-tag C-term., Amp., low expression ev-3.pdf ev-3.gb
pSpot4 vector,  E. coli, Spot-tag N-term., Amp., low expression ev-4.pdf ev-4.gb
pSpot5 vector, S. cerevisiae, Spot-tag N-term., Leu, CEN, low expression ev-5.pdf ev-5.gb
pSpot6 vector, S. cerevisiae, Spot-tag C-term., Leu, CEN, low expression ev-6.pdf ev-6.gb
pSpot7 vector, S. cerevisiae, Spot-tag N-term., Leu, 2µ, high expression ev-7.pdf ev-7.gb
pSpot8 vector, S. cerevisiae, Spot-tag C-term., Leu, 2µ, high expression ev-8.pdf ev-8.gb

 

SPECIFICATIONS

Configuration:

DNA Plasmid

Amount:

1.25 µg

Expression Level: High and low expression plasmids available
Resistance: Kan, Amp, & Leu avaiable
Spot-Tag Amini Acid Sequence: PDRVRAVSHWSS

Part Numbers

pSpot1, pSpot2, pSpot3, pSpot4, pSpot5, pSpot6, pSpot7, pSpot8, EP1

Storage:

store at -20°C


Spot-Tag Vectors

ORDERING - Spot-Tag Vectors

 

 

Spot Peptide

ORDERING - Spot peptide